View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_70 (Length: 345)
Name: NF3002_low_70
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 336
Target Start/End: Original strand, 37107207 - 37107524
Alignment:
| Q |
19 |
ccttgtccactcttgcatttattcctctcaggcataatactatcttacccttcaccttcatgggatccagagttccattctggcaaagtacgctgcaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37107207 |
ccttgtccactcttgcatttattcctctcaggcataatactatcttacccttcaccttcttggggtccagagttccattctggcaaagtacgctgcaata |
37107306 |
T |
 |
| Q |
119 |
attattgaactcgttaatattacattagcttcatataaactatactcactattatagcgttgtgtttatgccaaatgtaaatactgattcagcaatgata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37107307 |
attattgaactcgttaatattacattagcttcatataaactatactcactattatagcgttgtgtttatgccaaatgtaaatactgattcagcaatgata |
37107406 |
T |
 |
| Q |
219 |
ttcagttgtttgatacttacgcatcttcatttgttgcacttgccaatttagcatctgttgctttaataattgggtagaatttttgtgctaatattgcagt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||| | |||| |
|
|
| T |
37107407 |
ttcagttgtttgatacttacgcatcttcatttgttgcacttgccaatttagcatctgttgctttaataattgggtagaacttgtctgctaatctggcagc |
37107506 |
T |
 |
| Q |
319 |
cgataagctttccccctt |
336 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
37107507 |
tgataagctttctccctt |
37107524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University