View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_74 (Length: 334)
Name: NF3002_low_74
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 8 - 317
Target Start/End: Complemental strand, 22363228 - 22362919
Alignment:
| Q |
8 |
gtgtgactcaatttagtatattttttcttctcaaaatttaacatcacaattttaaagcttctattgccttgaagcaacaagtgaacatcaagtcattaga |
107 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22363228 |
gtgtgactcaatttagtatttttttacttctcaaaatttaacatcacaattttaaagcttctattgccttgaagcaacaagtgaacatcaagtcattaga |
22363129 |
T |
 |
| Q |
108 |
gaaatttagagtgaaattttcaacttggatgcaggggtagcaaagttgggattcatatatggagatgaactagaggaaaggagaataaagacgggggatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22363128 |
gaaatttagagtgaaattttcaacttggatgcaggggtagcaaagttgggattcatatatggagatgaactagaggaaaggagaataaagacaggggatt |
22363029 |
T |
 |
| Q |
208 |
tgtatgtaattccagcaggtactgtattttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttagg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22363028 |
tgtatgtaattccagcaggtactgtattttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttagg |
22362929 |
T |
 |
| Q |
308 |
tgatactttt |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
22362928 |
tgatactttt |
22362919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University