View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_77 (Length: 321)
Name: NF3002_low_77
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 300
Target Start/End: Complemental strand, 44261197 - 44260914
Alignment:
| Q |
18 |
aattttgagggaggaacctgacatatttcttcaatcttttgg-aagctcatatcattgtctgagaagaaatggtgacagtagattcgccgattgctatga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44261197 |
aattttgagggaggaacctaacatatttcttcaatcttttgggaagctcatatcattgtctgagaagaaatggtgacagtagattcaccgattgctatga |
44261098 |
T |
|
| Q |
117 |
cgaataacgctcttttgtttctggaggtggcttttacaagaatgctttacgatgatggagccttggaacatgtttataatataattttatctacttttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44261097 |
cgaataacgctcttttgtttctggaggtggcttttacaagaatgctttacgatgacggagccttggaacatgtttataatataattttatctacttttct |
44260998 |
T |
|
| Q |
217 |
ttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatgtgctgttgatggatcaaatgaata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44260997 |
ttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatgtgctgttgatggatcaaatgaata |
44260914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 28 - 103
Target Start/End: Complemental strand, 44265345 - 44265270
Alignment:
| Q |
28 |
gaggaacctgacatatttcttcaatcttttggaagctcatatcattgtctgagaagaaatggtgacagtagattcg |
103 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| ||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
44265345 |
gaggaacctaacacatttcttcaatcttttggcagctcatttctttgtctgagaagaaatggtggcagtagattcg |
44265270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 216 - 288
Target Start/End: Complemental strand, 44265151 - 44265085
Alignment:
| Q |
216 |
tttcatccttagagagcaattgctaacaatatactcctatctatagaacataaattatatgtgctgttgatgg |
288 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
44265151 |
tttcatccttagatagcaattgctaacaatata------tctgtagaacataaattatatgtgctgttgatgg |
44265085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University