View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_78 (Length: 321)
Name: NF3002_low_78
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 13 - 304
Target Start/End: Original strand, 8211940 - 8212231
Alignment:
| Q |
13 |
aaaataagctcagtggaaaaatacctgatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8211940 |
aaaataagctcagtggaaaaatacctaatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt |
8212039 |
T |
 |
| Q |
113 |
tccggcgtctttggttcagatttcaatgaggaacaataatttaagcggtggtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8212040 |
tccggcgtctttggttcagatttcaatgaggaacaataatttaagtggtagtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat |
8212139 |
T |
 |
| Q |
213 |
ttcagttcaaacaaaattaatggctatgttccttctatattctttcagcttccatctttgcaacagttaacactttcattcaacgaattttc |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8212140 |
ttcagttcaaacaaaatcaatggctatgttccttctatattctttcagcttccatctttgcaacagttaacactttcattcaacgaattttc |
8212231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University