View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_85 (Length: 310)
Name: NF3002_low_85
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 147 - 295
Target Start/End: Complemental strand, 8200948 - 8200800
Alignment:
| Q |
147 |
ctagattgcaatgaaactaaactatagtgtcatcacacttgtactatactggtgtgtgactcgtaaaggaggagtgaagtgatgtgaagagggtttccta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8200948 |
ctagattgcaatgaaactaaactatagtgtcatcacacttgtactatactggtgtgtgactcgtaaaggaggagtgaagtgatgtgaagagggtttccta |
8200849 |
T |
|
| Q |
247 |
aataggtaatgtgttatttgctatgaaaggaaaagtagggttggaatgt |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8200848 |
aataggaaatgtgttatttgctatgaaaggaaaagtagggttggaatgt |
8200800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 118
Target Start/End: Complemental strand, 8201063 - 8200965
Alignment:
| Q |
20 |
aatgatctgcactaagacaatactttagtgaacttgtgatatagattaacttcacttttttactctctttcactttccaaaatgcaatattaatagatg |
118 |
Q |
| |
|
|||||||| ||||| |||||||||||||| |||||| |||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8201063 |
aatgatcttcactactacaatactttagtgtacttgttctataacttcacttcactttttttctctctttcactttccaaaatgcaatattaatagatg |
8200965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University