View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_89 (Length: 285)
Name: NF3002_low_89
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_89 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 269
Target Start/End: Complemental strand, 34568650 - 34568398
Alignment:
| Q |
17 |
gaaatatttgaactactgcagaaagagattttattgatgtctcataaatcgaatgtgtaaaggataaatgtatacgggttaattcttgttatttgatttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34568650 |
gaaatatttgaactactgcagaaagagattttattgatgtctcataaatcgaatgtgtaaaggataaatgtatacgggttaatacttgttatttgatttg |
34568551 |
T |
|
| Q |
117 |
gtaatgtataatgtcggagctgcttgttttgcttctctgatgacacattttgatacaatatgctatatttggtacttaattgtttttaatcttattattg |
216 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34568550 |
gtcatgtataatgtgggagctgcttgttttgcttctctgatgaaacattttgatacaatatgctatatttggtacttaattgttttaaatcttattattg |
34568451 |
T |
|
| Q |
217 |
tttgagccgagtagacataactagtattgtaattttaatttatgttgcatatt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34568450 |
tttgagccgagtagacataactagtattgtaattttaatttatgttgcatatt |
34568398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 195
Target Start/End: Complemental strand, 8569206 - 8569135
Alignment:
| Q |
124 |
ataatgtcggagctgcttgttttgcttctctgatgacacattttgatacaatatgctatatttggtacttaa |
195 |
Q |
| |
|
||||||| ||| ||| |||||||| || |||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
8569206 |
ataatgttggatctggttgttttgattttctgatgacacattttgatatagtatgctatatttggtacttaa |
8569135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University