View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_93 (Length: 271)
Name: NF3002_low_93
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_93 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 32950493 - 32950749
Alignment:
| Q |
11 |
cagagagcagttaaatcaatatctaaataaaagac----------caaaacataaaccacatggattttcttcatcttaagcctccaactgcttttacac |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32950493 |
cagagagcagttaaatcaatatttaaataaaagactataaagggccaaaacataaaccacatggattttcttcatcttaagcctccaactgcttttaaac |
32950592 |
T |
|
| Q |
101 |
ttaagctgccttagtgatcctgggtggctggctgctttcgaacttcagttatcttagctttctgccttcggtcttcagctttctgcattctgtctttagc |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32950593 |
ttaagctgccttagcgatcctgggtggctggcttctttcgaacttca-ttatcttagctttctgctttcggtcttcagctttctgcattctgtctttagc |
32950691 |
T |
|
| Q |
201 |
tttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950692 |
tttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatct |
32950749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University