View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_96 (Length: 268)
Name: NF3002_low_96
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_96 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 32408664 - 32408903
Alignment:
| Q |
18 |
atgggcgggttgggaaagacggcgcttgcgcaattggtttataacgatgatgaagtggagaagatgttcgagaaacggatttgggtttgtgtttctcagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32408664 |
atgggcgggttgggaaagacggcgcttgcgcaattggtttataatgatgatgaagtggagaagatgttcgagaaacggatttgggtttgtgtttctcagg |
32408763 |
T |
|
| Q |
118 |
agtttgatgttaagtcgattttgagtaaaatgttaaaatcgttgaagaatggtgaagttggtgatttggagttggatattttacaaaggagggttcggga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32408764 |
agtttgatgttaagtcgattttgagtaaaatgttgaaatcgttgaagaatggtgaagttggtgatttggagttggatattttacaaaggagggttcggga |
32408863 |
T |
|
| Q |
218 |
agagttgaatgggcaaaggtatttgcttgtacttgatgat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32408864 |
agagttgaatgggcaaaggtatttgcttgtacttgatgat |
32408903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 79
Target Start/End: Original strand, 2980324 - 2980376
Alignment:
| Q |
27 |
ttgggaaagacggcgcttgcgcaattggtttataacgatgatgaagtggagaa |
79 |
Q |
| |
|
|||||||||||||| ||||| |||||||| || |||||||| |||||| |||| |
|
|
| T |
2980324 |
ttgggaaagacggctcttgctcaattggtatacaacgatgaagaagtgcagaa |
2980376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University