View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_97 (Length: 267)
Name: NF3002_low_97
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_97 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 35211922 - 35211688
Alignment:
| Q |
14 |
ttctccgttgatagctagcgtttaagggagagttcattaagtgcttggacatatatcaattggtattcgaaccagtaatcagtggctacctatggagggg |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35211922 |
ttctccgttgatagctagtgtttaagggagagttcattaagtgcttggacacatatcaattggtattcgaaccggtaatcagtggctacctatggagggg |
35211823 |
T |
|
| Q |
114 |
ccgactggaaaggctgagtaacccgttgtaaactacaaccgccaggacgtcggctctcaggggtggtggtatgatagggttttgggtattatggaattcc |
213 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35211822 |
ctgactggaaaggctgagtaacgtgttgtaaactacaaccgccaggacatcggctctcaggggtggtgctatgatagggttttgggtattatggaattcc |
35211723 |
T |
|
| Q |
214 |
caaatcccacatcgactagtctgggatgcttggtg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35211722 |
caaatcccacgtcgactagtctgggatgctcggtg |
35211688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University