View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3003_high_7 (Length: 322)
Name: NF3003_high_7
Description: NF3003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3003_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 314
Target Start/End: Original strand, 38813937 - 38814234
Alignment:
| Q |
17 |
agttatcgggcttgatgctgaatggcttctgttacatggcacggagccaggaacagttaccaaatccaaatgtgcaaccctgcagctctgtgatggacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
38813937 |
agttatcgggcttgatgctgaatggcttctgttacatggcacggagccaggaacagttaccaaatccaaatgtgcaacactgcagttctgtgatggacac |
38814036 |
T |
 |
| Q |
117 |
tcgtgtcttatcattcacctaaatggtttcaattgctttgagagttgggcatatgattctgtccacaaatcactgcttaattttcttcgtctcccaaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814037 |
tcgtgtcttatcattcacctaaatggtttcaattgctttgagagttgggcatatgattctgtccacaaatcactgcttaattttcttcgtctcccaaatg |
38814136 |
T |
 |
| Q |
217 |
ttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttgaacttggaccctatgct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38814137 |
ttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttgaacttggaccctttgct |
38814234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 186 - 304
Target Start/End: Original strand, 38818506 - 38818624
Alignment:
| Q |
186 |
tcactgcttaattttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgta |
285 |
Q |
| |
|
||||| ||||| ||||||||| | ||||||||||| ||||||||||||||||||||||| ||| |||| |||||||| | | ||||| ||||||||| |
|
|
| T |
38818506 |
tcactacttaactttcttcgtatgccaaatgttacctttgttggagttggaatcaaagacaatgtggccaagttggaaacatactatgggattggatgta |
38818605 |
T |
 |
| Q |
286 |
gaaatgctgttgaacttgg |
304 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
38818606 |
gaaatgctgtggaacttgg |
38818624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 309
Target Start/End: Original strand, 38820731 - 38820855
Alignment:
| Q |
185 |
atcactgcttaattttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgt |
284 |
Q |
| |
|
|||| ||||||||||||||||||| ||| || ||| |||||||| ||||| ||||| | ||||||||||| | |||||| | ||||| || |||| |
|
|
| T |
38820731 |
atcattgcttaattttcttcgtcttccagattatacctttgttggtgttggtatcaatcataatttggctaaacttgagaaggaatatggggttagatgc |
38820830 |
T |
 |
| Q |
285 |
agaaatgctgttgaacttggaccct |
309 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
38820831 |
agaaatgctgtggaacttggaccct |
38820855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University