View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3003_low_16 (Length: 245)
Name: NF3003_low_16
Description: NF3003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3003_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 18029316 - 18029096
Alignment:
| Q |
1 |
ttttttaaaatagaagaagtgctaatattgggttgaattggtaggatgattatagaagaagtgcatattttatcttatttctagaagttgttttcggatt |
100 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18029316 |
tttttttaaatagaagaagttctaatattgggttgaattggtaggatgattatagaagaagtgcatattttatcttatttctagaagttgttttcggatt |
18029217 |
T |
 |
| Q |
101 |
gatgatagaaagttttggtaatttgtttcgtaaattgattaannnnnnnnnnnnnggtgctatttggtttgtttaggaagattatagaccggaagaagat |
200 |
Q |
| |
|
||||||||| |||| |||| |||||||| | ||||||||| |||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18029216 |
gatgatagatagttgtggttatttgttttggaaattgatt------ttttttttttgtgcgatttggtttgtttaggaagattatagatcggaagaagat |
18029123 |
T |
 |
| Q |
201 |
ggagaagagggtaatgctggtggtgac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18029122 |
ggagaagagggtaatgctggtggtgac |
18029096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 222
Target Start/End: Complemental strand, 19678743 - 19678686
Alignment:
| Q |
168 |
tttgtttaggaagattatagacc---ggaagaagatggagaagagggtaatgctggtg |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
19678743 |
tttgtttaggaagattatagaccagaagaagaagatgaagaagatggtaatgctggtg |
19678686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 19678946 - 19678895
Alignment:
| Q |
42 |
taggatgattatagaagaagtgcatattttatcttatttctagaagttgtttt |
94 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||| ||||||| ||||| |
|
|
| T |
19678946 |
taggatgattatagaagaagagcata-ttcatcttatttttagaagtggtttt |
19678895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University