View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3003_low_19 (Length: 210)
Name: NF3003_low_19
Description: NF3003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3003_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 49994053 - 49994233
Alignment:
| Q |
19 |
ccaaggttgaggtttttggaaagggtgagcgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49994053 |
ccaaggttgaggtttttggaaagggtgagtgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagataatgttgaatgga |
49994152 |
T |
|
| Q |
119 |
aatttaagttgnnnnnnnnnnnnngtatggtggtgagtcttgtgggagtggtggtgggaagagtttgggggtttgatgatg |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49994153 |
aatttaagttgttttttactttttgtatggtggtgagtcttgtgggagtggtggtgggaagagtttgggggtttgatgatg |
49994233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 120
Target Start/End: Original strand, 25800028 - 25800093
Alignment:
| Q |
55 |
actattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaa |
120 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||| | ||||| | || ||||||||||| |
|
|
| T |
25800028 |
actatgggtatgtaggtgccaaggtcacccatggcaccatttaattcagcccattttgaatggaaa |
25800093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 49 - 116
Target Start/End: Complemental strand, 1874666 - 1874599
Alignment:
| Q |
49 |
gaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatg |
116 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||| | || ||||||| |
|
|
| T |
1874666 |
gaaagaactattggtatgtaggtgccaaggtcacccatggcaccatttagttcagcccattttgaatg |
1874599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University