View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_high_1 (Length: 500)
Name: NF3005_high_1
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 20 - 484
Target Start/End: Complemental strand, 49168583 - 49168119
Alignment:
| Q |
20 |
ctttcctatacaccgcggctaatttagtttcttggacacaatatatctggattatttttcccgatcacttgtacacatccttcttttttgctactcccct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168583 |
ctttcctatacaccgcggctaatttagtttcttggacacaatatatctggattatttttcccgatcacttgtacacatccttcttttttgctactcccct |
49168484 |
T |
 |
| Q |
120 |
caaccctctaaagttgtaacttataatcttcatgataaaattccttacttccacccacattgatcaggggctccacggctccacctccttcattagagtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168483 |
caaccctctaaagttgtaacttataatcttcatgataaaattccttacttccacccacattgatcaggggctccacggctccacctccttcattagagtt |
49168384 |
T |
 |
| Q |
220 |
accaatgccctgttttctctattttcatgaacatttaacggttgcgccaaccctccttcttcgcctgatttcactagaccgattccattcccaaactcct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168383 |
accaatgccctgttttctctattttcatgaacatttaacggttgcgccaaccctccttcttcgcctgatttcactagaccgattccattcccaaactcct |
49168284 |
T |
 |
| Q |
320 |
tgtgctactactctagaatcactatgcaatattgtcaaggatttccattatgtactatcaacgaaggtttattgagttcgaatgattgatacctgatttt |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168283 |
tgtgctactactctagaatcactatgcaataatgtcgaggatttccattatgtactatcaacaaaggtttattgagttcgaatgattgatacctgatttt |
49168184 |
T |
 |
| Q |
420 |
cgctgtttgtcctttccttttttcattcagaattgaacgccttctttttcttctgtctttagaac |
484 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49168183 |
cgccgtttgtcctttccttttttcattcagaattgaacgccttctttttcttctgtctttagaac |
49168119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University