View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_high_5 (Length: 341)
Name: NF3005_high_5
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_high_5 |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 5693315 - 5693623
Alignment:
| Q |
17 |
tccataactacactcaaaggcagatagcttaagatcaaaaactatgtaaatgggctttgaaggaaagcgaggatgaactctattagcttaagatccacgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5693315 |
tccataactacactcaaaggcagatagcttaagatcaaaaactatgtaaatgggctttgaaggaaagcgaggatgaactctattagcttaagatccacgt |
5693414 |
T |
 |
| Q |
117 |
gaaaggcaaaagctgagtgcgcctttattggtgtgcacagtgaaagaaaatgaaaataatag-nnnnnnnnnnnnccactcaaaaaagtgaaagttgtct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5693415 |
gaaaggcaaaagctgagtgcgcctttattggtgtgcacagcgaaagaaaatgaaaataatagtttttttttttttccactcaaaaaagtgaaagttgtct |
5693514 |
T |
 |
| Q |
216 |
ttctttactcnnnnnnnttaaagttgaatcattttagtcg--nnnnnnngtggcagtcggggtttcaaccacataccttgcatatattatgcattgttta |
313 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5693515 |
ttctttactcaaaaaaattaaagttgaatcattttagtcgtttttttttgtggcagtcggggtttcaaccacataccttgcatatattatgcattgttta |
5693614 |
T |
 |
| Q |
314 |
taacagcta |
322 |
Q |
| |
|
||||||||| |
|
|
| T |
5693615 |
taacagcta |
5693623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 20744203 - 20744162
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
20744203 |
gtcggggtttgaaccccagaccttgcatatattatgcattgt |
20744162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 310
Target Start/End: Original strand, 23629834 - 23629874
Alignment:
| Q |
270 |
tcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
23629834 |
tcggggtttgaacttcataccttgcatatattatgcattgt |
23629874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 14182 - 14224
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgtt |
311 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14182 |
gtcggggtttgaaccacataccttgcatatattatgcattgtt |
14224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 46093181 - 46093135
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgtttata |
315 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46093181 |
gtcggggtttaaaccacaaaccttgcatatattatgcattgtttata |
46093135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 12131669 - 12131715
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgtttata |
315 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
12131669 |
gtcggggtttaaacctcataccttgtatatattatgcattgtctata |
12131715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 318
Target Start/End: Original strand, 39100099 - 39100129
Alignment:
| Q |
288 |
accttgcatatattatgcattgtttataaca |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39100099 |
accttgcatatattatgcattgtttataaca |
39100129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 311
Target Start/End: Original strand, 20612275 - 20612315
Alignment:
| Q |
271 |
cggggtttcaaccacataccttgcatatattatgcattgtt |
311 |
Q |
| |
|
|||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
20612275 |
cggggtttgaaccccaaaccttgcatatattatgcattgtt |
20612315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 32760581 - 32760529
Alignment:
| Q |
263 |
gtggcagtcggggtttcaaccacataccttgcatatattatgcattgtttata |
315 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32760581 |
gtggtagtcggggtttgaaccacagaccttgcatattctatgcattgtttata |
32760529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 274 - 310
Target Start/End: Complemental strand, 30893993 - 30893957
Alignment:
| Q |
274 |
ggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
30893993 |
ggtttgaacctcataccttgcatatattatgcattgt |
30893957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 311
Target Start/End: Original strand, 31602815 - 31602863
Alignment:
| Q |
263 |
gtggcagtcggggtttcaaccacataccttgcatatattatgcattgtt |
311 |
Q |
| |
|
|||||||||||||||| || | | |||||||||||||||||||||||| |
|
|
| T |
31602815 |
gtggcagtcggggtttgaatctcgaaccttgcatatattatgcattgtt |
31602863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000008; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 280 - 315
Target Start/End: Complemental strand, 6228688 - 6228653
Alignment:
| Q |
280 |
aaccacataccttgcatatattatgcattgtttata |
315 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6228688 |
aacctcataccttgcatatattatgcattgtttata |
6228653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 312
Target Start/End: Original strand, 29896290 - 29896333
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgttt |
312 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
29896290 |
gtcggggtttgaaccccaaaccttgcatatattatgcattgttt |
29896333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 272 - 310
Target Start/End: Complemental strand, 22608589 - 22608551
Alignment:
| Q |
272 |
ggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
22608589 |
ggggtttgaacctcataccttgcatatattatgcattgt |
22608551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Original strand, 9547405 - 9547446
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
9547405 |
gtcggggtttgaaccccaaaccttgcatatattatgcattgt |
9547446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 29734756 - 29734715
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
29734756 |
gtcggggtttgaaccacggaccttgcatatattatgcattgt |
29734715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Original strand, 26991753 - 26991794
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26991753 |
gtcgtggtttgaaccacaaaccttgcatatattatgcattgt |
26991794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 274 - 310
Target Start/End: Complemental strand, 498791 - 498755
Alignment:
| Q |
274 |
ggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
498791 |
ggtttaaaccacagaccttgcatatattatgcattgt |
498755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 10026059 - 10026018
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
10026059 |
gtcggggtttgaaccccataccttgcatattttatgcattgt |
10026018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Complemental strand, 21580881 - 21580840
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
21580881 |
gtcggggtttgaaccatataccttacatatattatgcattgt |
21580840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Original strand, 22630356 - 22630397
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
22630356 |
gtcggggtttgaacctcagaccttgcatatattatgcattgt |
22630397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Original strand, 37930843 - 37930884
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
37930843 |
gtcggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 272 - 312
Target Start/End: Original strand, 3299093 - 3299133
Alignment:
| Q |
272 |
ggggtttcaaccacataccttgcatatattatgcattgttt |
312 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
3299093 |
ggggtttgaacctcaaaccttgcatatattatgcattgttt |
3299133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 310
Target Start/End: Original strand, 6267435 - 6267476
Alignment:
| Q |
269 |
gtcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
6267435 |
gtcggggtttgaaccacatatcttgcatattttatgcattgt |
6267476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 310
Target Start/End: Complemental strand, 22335422 - 22335382
Alignment:
| Q |
270 |
tcggggtttcaaccacataccttgcatatattatgcattgt |
310 |
Q |
| |
|
||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
22335422 |
tcggggtttgaacctcagaccttgcatatattatgcattgt |
22335382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University