View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_high_7 (Length: 329)
Name: NF3005_high_7
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 29624418 - 29624116
Alignment:
| Q |
18 |
gtttcaatgaattctatat--tgtggttttgatgaaattggttcccttttattgatgaaatagaaagttgttcttgatttttgatttattttgttttgat |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29624418 |
gtttcaatgaattctatatattgtggttttgatgaaattgattcccttttatggatgaaatagaaagttgttctt-atttttgatttattttgttttgat |
29624320 |
T |
|
| Q |
116 |
gacagatgagaaattttcaagctttggaaataatagtatcgttgtatgcttgtattacaagtttgataaataattaggggaggaagtcattgaaactctt |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29624319 |
gacagatgataaattttcaagctttggaaataatagtatcattgtatgcttgtattacaagtttgataaataattaggggaggaagtaattgaaactctt |
29624220 |
T |
|
| Q |
216 |
gtgtatgatgttgtcatgggatgcttagttattgtgagacagtagtttcaacatttctttagggtttgttgcaattgtagtggctttgtttcattctgtc |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29624219 |
gtgtatgatgttatcatgggatgcttagttattgtgagacagtagtttcagcgtttctttagggtttgttgcaattgtagtggctttgtttcattctgtc |
29624120 |
T |
|
| Q |
316 |
tgtg |
319 |
Q |
| |
|
|||| |
|
|
| T |
29624119 |
tgtg |
29624116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University