View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_low_16 (Length: 267)
Name: NF3005_low_16
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 151 - 256
Target Start/End: Original strand, 8807743 - 8807848
Alignment:
| Q |
151 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagtgacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807743 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagggacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
8807842 |
T |
 |
| Q |
251 |
gttcat |
256 |
Q |
| |
|
|||||| |
|
|
| T |
8807843 |
gttcat |
8807848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 8807593 - 8807689
Alignment:
| Q |
1 |
gaatggaaatggaacatggagttttccacatgtttcattgcatgaattttttggaagcataggtggttcaactagttttgtttgcacttgttggagg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807593 |
gaatggaaatggaacatggagttttccacatgtttcattgcatgaattttttggaagcaaaggtggttcaactagttttgtttgcacttgttggagg |
8807689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University