View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_low_28 (Length: 228)
Name: NF3005_low_28
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 209
Target Start/End: Original strand, 2890595 - 2890799
Alignment:
| Q |
5 |
tgtattttggatgactcacattgggatgtaagtcctaaagatgacaagctcttgttggtcttgtctagaaatgaggatcttgtgatttttaaacttgtag |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2890595 |
tgtattttggatgattcacattgggatgtaagttctaaagatgacaagctcttgttggtcttgtctagaaatgaggatcttgtgatttttaaactcgtag |
2890694 |
T |
|
| Q |
105 |
aatgtgtaacaaacaatgctacctcttatacatgggaagagatgggtaccatccatcatatgcttttagggcctcttaatacacatggtaaattgttatc |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2890695 |
aatgtgtagcaaacaatgctacctcttatacatgggaagagatgagtaccatccatcatatgcttttagggcctcttaatacacatgggaaattgttatc |
2890794 |
T |
|
| Q |
205 |
ctttc |
209 |
Q |
| |
|
||||| |
|
|
| T |
2890795 |
ctttc |
2890799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University