View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3005_low_29 (Length: 218)
Name: NF3005_low_29
Description: NF3005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3005_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 9344470 - 9344268
Alignment:
| Q |
1 |
caactgcatcatccactgtctctgactgactcatgtgacccttttcatttcccacacgtgctcgacctcaacaaattctccctcctccatttgggatgca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9344470 |
caactgcatcatccactgtctgtgactgactcatgtgacccttttcatttcccacacgtgctcgacctcaacaaattctccctcctccatttgggatgca |
9344371 |
T |
|
| Q |
101 |
tgttcactgtagacgacaacttccctgaactctctccttttgacttcatatatactcctgaaaagatcgctattctcacgctccatggaaaaaaccctat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9344370 |
tgttcactgtagacgacaacttccctaaa--ctctccttttgacttcatatatactcctgaaaagatcgctattctcacgctccatggaaaaaaccctat |
9344273 |
T |
|
| Q |
201 |
tgttc |
205 |
Q |
| |
|
||||| |
|
|
| T |
9344272 |
tgttc |
9344268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 35 - 141
Target Start/End: Complemental strand, 9448904 - 9448798
Alignment:
| Q |
35 |
gtgacccttttcatttcccacacgtgctcgacctcaacaaattctccctcctccatttgggatgcatgttcactgtagacgacaacttccctgaactctc |
134 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| | ||| |||||||||||||||||||||||||||||||||| | ||| |||||||||| ||||| ||| |
|
|
| T |
9448904 |
gtgacccttttcattttccacatgtgctcgattttaaccaattctccctcctccatttgggatgcatgttcaccgcagatgacaacttccttgaaccctc |
9448805 |
T |
|
| Q |
135 |
tcctttt |
141 |
Q |
| |
|
||||||| |
|
|
| T |
9448804 |
tcctttt |
9448798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University