View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3006_high_18 (Length: 241)
Name: NF3006_high_18
Description: NF3006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3006_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39641958 - 39642178
Alignment:
| Q |
1 |
ccgtaaacaggttcgcacaacgaaagcaacaccgtttcatcattgttcgccagtgctactgcgttcaatccactctcaacatcttcagctgtgaactccg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39641958 |
ccgtaaacaggttcgcacaacggaagcaacaccgtttcatcattgttcgccagtgctactgcgttcaatccactctcaacatcttcagctgtgaactccg |
39642057 |
T |
|
| Q |
101 |
caaagtcgtgaaaaccagtgaattgtttgatgtatttcaacgccgatgaaagctccggtacgtttccgttggcgtggtctagttgccggattccgaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39642058 |
caaagtcgtgaaaaccagtgaattgtttgatgtatttcaacgccgatgaaagctccggtacgtttccgttggcgtggtctagttgccggattccgaaatc |
39642157 |
T |
|
| Q |
201 |
tagtgatgaattagatgattc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39642158 |
tagtgatgaattagatgattc |
39642178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 94 - 218
Target Start/End: Original strand, 39637369 - 39637493
Alignment:
| Q |
94 |
aactccgcaaagtcgtgaaaaccagtgaattgtttgatgtatttcaacgccgatgaaagctccggtacgtttccgttggcgtggtctagttgccggattc |
193 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||| ||||||||| | ||||||| |
|
|
| T |
39637369 |
aactcagcaaactcgtgaaaaccggtgaattgtttgatgtacttcaacgccggtgaaagctctggtacgtttccgacggcatggtctagtcgtcggattc |
39637468 |
T |
|
| Q |
194 |
cgaaatctagtgatgaattagatga |
218 |
Q |
| |
|
|||| |||| |||| | |||||||| |
|
|
| T |
39637469 |
cgaagtctactgataagttagatga |
39637493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 77 - 221
Target Start/End: Complemental strand, 39680206 - 39680062
Alignment:
| Q |
77 |
caacatcttcagctgtgaactccgcaaagtcgtgaaaaccagtgaattgtttgatgtatttcaacgccgatgaaagctccggtacgtttccgttggcgtg |
176 |
Q |
| |
|
|||| ||||| ||||||||||| ||||| || |||||||| ||||||||||| | |||||||| ||| ||||||||||||||||| |||||| ||| || |
|
|
| T |
39680206 |
caacgtcttccgctgtgaactcagcaaattcatgaaaaccggtgaattgtttcacgtatttcaccgctgatgaaagctccggtacatttccgacggcatg |
39680107 |
T |
|
| Q |
177 |
gtctagttgccggattccgaaatctagtgatgaattagatgattc |
221 |
Q |
| |
|
||||||| |||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
39680106 |
gtctagtcttcggattccaaaatctaacgatgaattagaagattc |
39680062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 7055820 - 7056049
Alignment:
| Q |
1 |
ccgtaaacaggttcgcacaacgaaagcaacaccgtttcatcattgttcgccagtgctactgcgttcaatccactctca---------acatcttcagctg |
91 |
Q |
| |
|
||||||| |||||||| | || ||||||||| |||||||||||| |||| ||| |||| |||||| ||||||||| || ||||| | || |
|
|
| T |
7055820 |
ccgtaaatgggttcgcatatcggaagcaacacagtttcatcattgctcgctagtactacattgttcaaaccactctcactcgttccaacgtcttctgttg |
7055919 |
T |
|
| Q |
92 |
tgaactccgcaaagtcgtgaaaaccagtgaattgtttgatgtatttcaacgccgatgaaagctccggtacgtttccgttggcgtggtctagttgccggat |
191 |
Q |
| |
|
| ||||| ||||| ||||||||||| ||||||||||||||||| |||| |||||||| |||||| || |||||| ||||||| ||||||||| |||||| |
|
|
| T |
7055920 |
taaactcagcaaactcgtgaaaaccggtgaattgtttgatgtacttcaccgccgatgcaagctctggaacgtttgcgttggcatggtctagtctccggat |
7056019 |
T |
|
| Q |
192 |
tccgaaatctagtgatgaattagatgattc |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
7056020 |
tccgaaatctagtgatgagttagatgattc |
7056049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University