View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3006_low_13 (Length: 309)
Name: NF3006_low_13
Description: NF3006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3006_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 34678027 - 34677814
Alignment:
| Q |
19 |
cacacaagttaaacagtttaacttgaagattcataagtcataacactacgtatagttccatctagaataatcaaaataacggcttagctttttgttgttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678027 |
cacacaagttaaacagtttaacttgaagattcataagtcataacactacgtatagttccacctagaataatcaaaataacggcttagctttttgttgttc |
34677928 |
T |
 |
| Q |
119 |
tgttttcatgaaaatgaaaggctaacttcactgttagtattttctcttctggaaacatggagagcaaatgcagctgaacatgtagcttagaaaacactgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34677927 |
tgttttcatgaaaatgaaaggctaacttcactgttagtattttctcttctggaaacatggagagcaaatgcagctgaacatgtagcttagaaaactctgc |
34677828 |
T |
 |
| Q |
219 |
tatagtttcttcta |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34677827 |
tatagtttcttcta |
34677814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 255 - 300
Target Start/End: Complemental strand, 34677780 - 34677735
Alignment:
| Q |
255 |
attctaatcatagataaaacaaccctaactctcctattagtattat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34677780 |
attctaatcatagataaaacaaccctaactctcctattagtattat |
34677735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University