View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3006_low_16 (Length: 272)
Name: NF3006_low_16
Description: NF3006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3006_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 24026168 - 24025917
Alignment:
| Q |
1 |
aaactatgaagttaagagatcgaagtggaatcactacgctgctagtattgttattgtgcttaacaactctctttctaaaaacagaagctatatggttgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24026168 |
aaactatgaagttaagagatcgaagtggaatcactatgctgctagtattgttattgtgcttaacaactctctttctaaaaacagaagctatatggttgac |
24026069 |
T |
 |
| Q |
101 |
cattccaagttcaggtactaaatgtgtgtctgaggatattcaaacacatgtcgttgttttagctgattactatgttgttgctgatgaaggtcttcacact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24026068 |
tattccaagttcaggtactaaatgtgtgtctgaggatattcaaacacatgtcgttgttttagctgattactatgttgttgctgatgaaggtcttcacact |
24025969 |
T |
 |
| Q |
201 |
atttccgcaaaggtattgcttagtttagataaattaattaactatttcttgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24025968 |
atttccgcaaaggtattgcttagtttagataaattaattaactatttcttgt |
24025917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 181
Target Start/End: Complemental strand, 32664696 - 32664623
Alignment:
| Q |
108 |
agttcaggtactaaatgtgtgtctgaggatattcaaacacatgtcgttgttttagctgattactatgttgttgc |
181 |
Q |
| |
|
|||||||| ||||| || ||||| ||||||| |||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
32664696 |
agttcaggaactaagtgcgtgtcgcaggatatccaaacacacgttgttgttttagccaattactatgttgttgc |
32664623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University