View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3009_high_12 (Length: 263)
Name: NF3009_high_12
Description: NF3009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3009_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 134 - 248
Target Start/End: Complemental strand, 41885408 - 41885294
Alignment:
| Q |
134 |
ctatctgaatgagtttgaattgcatttatgataaattcttatatgattgatatgtgcactcgaacttctnnnnnnnnnnnnttgaaatacgtctcacaca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
41885408 |
ctatctgaatgagtttgaattgcatttatgataaattcttatatgattgatatgtgcactcgaacttctaaaaagaaaaaattgaaatacatctcacaca |
41885309 |
T |
 |
| Q |
234 |
agtataagagaaaag |
248 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41885308 |
agtataagagaaaag |
41885294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 41886746 - 41886656
Alignment:
| Q |
14 |
agagcatttggcacttatttctcnnnnnnnntcttaatattggctgaaactcatgcatctcttattttgttgatactatttcctatgggtg |
104 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||| |
|
|
| T |
41886746 |
agagcatttggcacttctttctcaaaaaaattcttaatattggctgaaactcatgtatgtcttattttgttgatactatttcctattggtg |
41886656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University