View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3009_high_13 (Length: 261)
Name: NF3009_high_13
Description: NF3009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3009_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 42767880 - 42768107
Alignment:
| Q |
15 |
agaatatagtaaggcgagaacctttgtagccacggttgcacaaatagttcgtatagtcggtgatatttaggtcataaacaagtccagggtccacggcatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42767880 |
agaatatagtaaggcgagaacctttgtagccacggttgcacaaatagttcgtatagtcggtgatatttaggtcataaacaagtccagggtccacggcatg |
42767979 |
T |
 |
| Q |
115 |
attaggttggacgtgccccgcaccatatgcaaatggatttgcgtttatgcgtgttgaatccaatataggctttcctgtattatcttttattctcgctgca |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42767980 |
attaggttggacttgccccgcaccatatgcaaatggatttgcgtttatgcgtgttgaatccaatataggctttcctgtattatcttttattctcgctgca |
42768079 |
T |
 |
| Q |
215 |
aaatatttgaatttgttttagtattata |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42768080 |
aaatatttgaatttgttttagtattata |
42768107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 123
Target Start/End: Original strand, 42715229 - 42715314
Alignment:
| Q |
38 |
ttgtagccacggttgcacaaatagttcgtatagtcggtgatatttaggtcataaacaagtccagggtccacggcatgattaggttg |
123 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||| || |||||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
42715229 |
ttgtagccacgagcgcacaaaaagttcatatagtcagtaatatttaggtcatatacaagtccagggtcgaccacacgattaggttg |
42715314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 42742185 - 42742253
Alignment:
| Q |
77 |
atatttaggtcataaacaagtccagggtccacggcatgattaggttggacgtgccccgcaccatatgca |
145 |
Q |
| |
|
|||||||||||||| |||||||| || || ||||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
42742185 |
atatttaggtcatacacaagtccgggatctgcggcaagattaggtcgaacgtgccctgcaccatatgca |
42742253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 42751544 - 42751612
Alignment:
| Q |
77 |
atatttaggtcataaacaagtccagggtccacggcatgattaggttggacgtgccccgcaccatatgca |
145 |
Q |
| |
|
|||||||||||||| ||||||||||| || | ||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
42751544 |
atatttaggtcatacacaagtccaggatctgctgcaagattaggtcgaacgtgccctgcaccatatgca |
42751612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 42761006 - 42761074
Alignment:
| Q |
77 |
atatttaggtcataaacaagtccagggtccacggcatgattaggttggacgtgccccgcaccatatgca |
145 |
Q |
| |
|
|||||||||||||| ||||||||||| || | ||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
42761006 |
atatttaggtcatacacaagtccaggatctgctgcaagattaggtcgaacgtgccctgcaccatatgca |
42761074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 145
Target Start/End: Complemental strand, 23042314 - 23042246
Alignment:
| Q |
77 |
atatttaggtcataaacaagtccagggtccacggcatgattaggttggacgtgccccgcaccatatgca |
145 |
Q |
| |
|
|||||||||||||| ||||||||||| || | ||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
23042314 |
atatttaggtcatacacaagtccaggatctgctgcaagattaggtcgaacgtgccctgcaccatatgca |
23042246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 77 - 156
Target Start/End: Complemental strand, 42315726 - 42315647
Alignment:
| Q |
77 |
atatttaggtcataaacaagtccagggtccacggcatgattaggttggacgtgccccgcaccatatgcaaatggatttgc |
156 |
Q |
| |
|
||||| || ||||||| ||||||||||| | ||| |||||||||| ||||| |||| |||||||||||||||| |||| |
|
|
| T |
42315726 |
atattaagatcataaattagtccagggtctatagcaagattaggttgaacgtgacccgaaccatatgcaaatggagttgc |
42315647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University