View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3009_low_18 (Length: 216)
Name: NF3009_low_18
Description: NF3009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3009_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 31445109 - 31444912
Alignment:
| Q |
1 |
tggcttaagcaaatggtctttgattgtagcaatccaagttattaccggtagtcgttcccaacaattgacaatatcttttaaaaaacccgattcggtcttc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31445109 |
tggcttaagcaaatggcctttgattgtagcaatccaagttatcaccggtagtcgttctcaacaattgacaatatcttttataaaacccgatccggtcttc |
31445010 |
T |
|
| Q |
101 |
gacccgaggatcctgaccgcgtccacattcaagcccgccgttgattatgttggtgatcacgccatatccgggtaccctcccagctgacctgtcagcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31445009 |
gacccgaggatcctgaccgcgtccacattcaagcccgccgttgattatgttggtgatcacgccatatccgggtaccctccttgctgacctgtcagcat |
31444912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 3 - 197
Target Start/End: Complemental strand, 31430786 - 31430592
Alignment:
| Q |
3 |
gcttaagcaaatggtctttgattgtagcaatccaagttattaccggtagtcgttcccaacaattgacaatatcttttaaaaaacccgattcggtcttcga |
102 |
Q |
| |
|
||||| |||||||| ||||| |||| |||||||||||||| |||| || |||||| | ||||||||| ||| || |||| |||| || || |||| |
|
|
| T |
31430786 |
gcttaggcaaatggcctttggttgttacaatccaagttattgccggggttcactcccaatatttgacaataccttctataaaatccgacccgatcctcga |
31430687 |
T |
|
| Q |
103 |
cccgaggatcctgaccgcgtccacattcaagcccgccgttgattatgttggtgatcacgccatatccgggtaccctcccagctgacctgtcagca |
197 |
Q |
| |
|
| ||||||||||||| | || ||||| |||||||||||||||||||||||||||||||| |||||||| |||| ||| ||||| ||||||||| |
|
|
| T |
31430686 |
ctttaggatcctgaccgtgcccgcattcgagcccgccgttgattatgttggtgatcacgccgtatccggggacccgccctgctgagctgtcagca |
31430592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 193
Target Start/End: Complemental strand, 31434912 - 31434722
Alignment:
| Q |
3 |
gcttaagcaaatggtctttgattgtagcaatccaagttattaccggtagtcgttcccaacaattgacaatatcttttaaaaaacccgattcggtcttcga |
102 |
Q |
| |
|
||||||||||||| |||||| |||| |||||||||||||| ||| | | || |||||| | ||||||||| ||| || |||||||||| || || | | |
|
|
| T |
31434912 |
gcttaagcaaatgatctttggttgttgcaatccaagttatcaccaggactcactcccaatatttgacaataccttctataaaacccgatccgatcattaa |
31434813 |
T |
|
| Q |
103 |
cccgaggatcctgaccgcgtccacattcaagcccgccgttgattatgttggtgatcacgccatatccgggtaccctcccagctgacctgtc |
193 |
Q |
| |
|
| |||| |||||| || | || ||||| ||||| |||||||||||||||||||||||||| |||||||| |||| || ||||||||||| |
|
|
| T |
31434812 |
ctcgagcatcctgtccatgcccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccggctgacctgtc |
31434722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University