View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3009_low_22 (Length: 201)
Name: NF3009_low_22
Description: NF3009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3009_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 75 - 186
Target Start/End: Complemental strand, 7587791 - 7587680
Alignment:
| Q |
75 |
caaccatttctaattttggtgtcttcactatttctagtttgttggcaagtgatttgattttgctatatatgtttgcagccttcaaatgatgaaaattttg |
174 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7587791 |
caaccgtttctaattttagtgtcttcactatttctagtttgttggctagtgatttgattttgctatatatgtttgcagccttcaaatgatgaaaattttg |
7587692 |
T |
 |
| Q |
175 |
actttgcctttg |
186 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7587691 |
actttgcctttg |
7587680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University