View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3009_low_22 (Length: 201)

Name: NF3009_low_22
Description: NF3009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3009_low_22
NF3009_low_22
[»] chr8 (1 HSPs)
chr8 (75-186)||(7587680-7587791)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 75 - 186
Target Start/End: Complemental strand, 7587791 - 7587680
Alignment:
75 caaccatttctaattttggtgtcttcactatttctagtttgttggcaagtgatttgattttgctatatatgtttgcagccttcaaatgatgaaaattttg 174  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
7587791 caaccgtttctaattttagtgtcttcactatttctagtttgttggctagtgatttgattttgctatatatgtttgcagccttcaaatgatgaaaattttg 7587692  T
175 actttgcctttg 186  Q
    ||||||||||||    
7587691 actttgcctttg 7587680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University