View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3010-Insertion-12 (Length: 281)
Name: NF3010-Insertion-12
Description: NF3010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3010-Insertion-12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 209
Target Start/End: Complemental strand, 26969325 - 26969122
Alignment:
| Q |
6 |
catgaataagatgggtgagtataaggattatacagctgagaaggcgaaggaagggaaggataatacagcatggaagattggtgagatgaaagactctgct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26969325 |
catgaataagatgggtgagtataaggattatacagctgagaaggcgaaggaagggaaggataatacagcgtggaagattggtgagatgaaggactctgct |
26969226 |
T |
|
| Q |
106 |
gttgatgcggcgaaacgggctatgggttacttgggtgacaagaaagaggaagctaaggagaaaactgcagagacagcggaagctgctaaacagaaaactg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26969225 |
gttgatgcggcgaaacgggctatgggttacttgggtgacaagaaagaggaagctaaacagaaaactgcagagacagcagaagctgctaaacagaaaactg |
26969126 |
T |
|
| Q |
206 |
caga |
209 |
Q |
| |
|
|||| |
|
|
| T |
26969125 |
caga |
26969122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 164 - 281
Target Start/End: Complemental strand, 26969134 - 26969017
Alignment:
| Q |
164 |
agaaaactgcagagacagcggaagctgctaaacagaaaactgcagaaaccactgaggctgctaagcaaaagacagtagaggcaaaagacaagaccaaggt |
263 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || | || |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969134 |
agaaaactgcagagacagcagaagctgctaaacagaaaactgcagagacagcagaagctgctaaacaaaagacagtagaggcaaaagacaagaccaaggt |
26969035 |
T |
|
| Q |
264 |
aacgaatttgaatttatg |
281 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
26969034 |
aacaaatttgaatttatg |
26969017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 62
Target Start/End: Complemental strand, 26969391 - 26969335
Alignment:
| Q |
6 |
catgaataagatgggtgagtataaggattatacagctgagaaggcgaaggaagggaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
26969391 |
catgaataagatgggtgagtataaggattatacggctgagaaggcgaaagaagggaa |
26969335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University