View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3010-Insertion-14 (Length: 128)
Name: NF3010-Insertion-14
Description: NF3010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3010-Insertion-14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 5e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 23884052 - 23884127
Alignment:
| Q |
7 |
agaaacccctcttta-tttttatgcttcaagttttacatgaaaatatttttatgagtcttatacacaacggttatg |
81 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23884052 |
agaaacccctctttactttttatgcttcaagttttacatgaaaagatttttatgagtcttatacacaacagttatg |
23884127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 74
Target Start/End: Original strand, 18594679 - 18594746
Alignment:
| Q |
7 |
agaaacccctcttta-tttttatgcttcaagttttacatgaaaatatttttatgagtcttatacacaac |
74 |
Q |
| |
|
|||||| |||||||| |||||||||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
18594679 |
agaaacacctctttactttttatgct-caagttttacatgaaaagatttttatgagtctgatacacaac |
18594746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 40 - 74
Target Start/End: Complemental strand, 24981381 - 24981347
Alignment:
| Q |
40 |
tacatgaaaatatttttatgagtcttatacacaac |
74 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
24981381 |
tacatgaaaagatttttatgagtcttatacacaac |
24981347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University