View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3010-Insertion-15 (Length: 102)
Name: NF3010-Insertion-15
Description: NF3010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3010-Insertion-15 |
 | |
|
| [»] scaffold0229 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0229 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 16504 - 16423
Alignment:
| Q |
21 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctggccattgttattttttgaggcaactatccaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16504 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctaaccattgttattttttgaggcaactatccaa |
16423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 21 - 102
Target Start/End: Original strand, 1401854 - 1401935
Alignment:
| Q |
21 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctggccattgttattttttgaggcaactatccaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1401854 |
aatttttccattatcatattcagatgagaggcatgcttttcatcagacctaaccattgttattttttgaggcaactatccaa |
1401935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University