View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3010R-Insertion-11 (Length: 243)
Name: NF3010R-Insertion-11
Description: NF3010R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3010R-Insertion-11 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 26969319 - 26969553
Alignment:
| Q |
9 |
attcagggtggcatctttcccttctttcgccttctcagccgtataatccttatactcacccatcttattcatggtagcatcttttccttcctttgccttt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969319 |
attcatggtggcatctttcccttctttcgccttctcagccgtataatccttatactcacccatcttattcatggtagcatcttttccttcctttgccttt |
26969418 |
T |
|
| Q |
109 |
tccgcagcatagtctttgtactccccagctttgtccttggcttcccttgctttctctccggcataacctgcatactcattagttttctgcatcgttgcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969419 |
tccgcagcatagtctttgtactccccagctttgtccttggcttcccttgctttctctccggcataacctgcatactcattagttttctgcatcgttgcat |
26969518 |
T |
|
| Q |
209 |
cttttgtttccttcgccttctgagctgttgcgtct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969519 |
cttttgtttccttcgccttctgagctgttgcgtct |
26969553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 26969269 - 26969351
Alignment:
| Q |
25 |
ttcccttctttcgccttctcagccgtataatccttatactcacccatcttattcatggtagcatcttttccttcctttgcctt |
107 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| || ||||| |
|
|
| T |
26969269 |
ttcccttccttcgccttctcagctgtataatccttatactcacccatcttattcatggtggcatctttcccttctttcgcctt |
26969351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University