View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3010_high_10 (Length: 238)

Name: NF3010_high_10
Description: NF3010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3010_high_10
NF3010_high_10
[»] chr8 (1 HSPs)
chr8 (1-159)||(36291174-36291333)


Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 36291174 - 36291333
Alignment:
1 cctaattaaggggaaaatgaaatgaagggaaagagggtcgattggtatcttgtagctaatggagtttagttgaggtttacaggggaattggagttacaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
36291174 cctaattaaggggaaaatgaaatgaagggaaagagggtcgattggtatcttgtagttaatggagtttagttgaggtttacaggggaattggagttacaat 36291273  T
101 ttggcagttacttactagaagggtcttcaatgtttgag-aattgaaaggttcctcgctaa 159  Q
    |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||    
36291274 ttggcagttacttactaggagggtcttcaatgtttgagcaattgaaaggttcctcgctaa 36291333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University