View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_high_13 (Length: 401)
Name: NF3011_high_13
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 18 - 389
Target Start/End: Original strand, 7524438 - 7524809
Alignment:
| Q |
18 |
ataatacaaagaaacaccaccaaaaactctaccatcaccaagaacaacatcagcaggaaactctctatcaatcgtcgaagcaccaactgtcaaaatccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7524438 |
ataatacaaagaaacaccaccaaaaactctaccatcaccaagaacaacatcagcaggaaactctctatcaatcgtcgaagcaccaactgtcaaaatccaa |
7524537 |
T |
|
| Q |
118 |
ggagctatattaacagaagtataaggaccaggtcctgaattacctgcagaacaagaaacaacaacaccatgttgtgcagcaccaaaagcaccaatagcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7524538 |
ggagctatattaacagaagtataaggaccaggtcctgaattacctgcagaacaagaaacaacaacaccatgttgtgcagcaccaaaagcaccgatagcaa |
7524637 |
T |
|
| Q |
218 |
tcgaatcacgataataatgaggcgcataaccactagaaccaaccgaaagcgaaatcacatgaaccccatcagcaacagcttcatccatagcagcaagaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7524638 |
tcgaatcacgataataatgaggcgcataaccattagaaccaaccgaaagtgaaatcacatgaaccccatcagcaacagcttcatccatagcagcaagaat |
7524737 |
T |
|
| Q |
318 |
atcagaatcaaaacaaccaagtttccaacagattttataagcagcaattctagcttttgttgccattccctt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7524738 |
atcagaatcaaaacaaccaagtttccaacagattttataagcagcaattctagcttttgttgccattccctt |
7524809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University