View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_high_37 (Length: 241)
Name: NF3011_high_37
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 37836331 - 37836532
Alignment:
| Q |
20 |
agagactatcaataggacaaagcataaacgattagaaacataagtagctaaaagccacagcccatttgaaatctaagttaaatttaatctaaacttgtct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37836331 |
agagactatcaataggacaaagcataaacgattagaaacataagtagctaaaagccacagcccatttgaaatttaagttaaatttaatctaaacttgtct |
37836430 |
T |
|
| Q |
120 |
aagtttttatgattcgtgtatgnnnnnnnnnnnnnnnnnnnngtcacttacttaaaccaggctatatggcaacatagggttaaacaattgctagcagcct |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37836431 |
aagtttttatgattcgtgtatgttttttagaattttgtttttgtcacttacttaaaccaggctatatggcaacatagggttaaacaattgctagcagcct |
37836530 |
T |
|
| Q |
220 |
ag |
221 |
Q |
| |
|
|| |
|
|
| T |
37836531 |
ag |
37836532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University