View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_high_40 (Length: 233)
Name: NF3011_high_40
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 12 - 219
Target Start/End: Complemental strand, 23077288 - 23077075
Alignment:
| Q |
12 |
gagaagaagaaaatttgaaggggtatcttaannnnnnnactagattcttgacaaggatcaaggtgattgtgcattaactaatttgattattatgtataca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23077288 |
gagaagaagaaaatttgaaggggtatcttaattttttcactagattcttgacaaggatcaaggtgattgtgcattaactaatttgattattatgtataca |
23077189 |
T |
 |
| Q |
112 |
cttgttattatta----tattattgaaaccatgatcaatggtttactacccaataaagagtttgtctactttctgttcatctttaatttgtttatatat- |
206 |
Q |
| |
|
||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
23077188 |
cttgttattataattattattattgaaaccctgatcaatggtttactacccaataaagagtttgtctactttttgttcatctttatttttcttatatata |
23077089 |
T |
 |
| Q |
207 |
-atattgtggggac |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23077088 |
catattgtggggac |
23077075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University