View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_high_6 (Length: 517)
Name: NF3011_high_6
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 11 - 500
Target Start/End: Original strand, 47948352 - 47948844
Alignment:
| Q |
11 |
cacagatttatgaatatttagagctctagttaaaagcttgatatctttaggaatgatattcacctcgtttgttgtctggctactatttactatggctaac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47948352 |
cacagatttatgaatatttagagctctagttaaaagcttgatatctttaggaatgatattcacctcgtttgttgtctggctactatttactatggctaat |
47948451 |
T |
|
| Q |
111 |
tgtcttatcattctatggtcagtgtttataattttctatcatgtggagtttggcaatactaatctaagaactcaaaagtgtgctggatatgatatgtcaa |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47948452 |
tgtcttatcattgtatggtcagtgtttataattttctatcatgtggagtttggcaatactaatctaagaactcaaaagtgtgctggatatgatatgtcaa |
47948551 |
T |
|
| Q |
211 |
ccgcatgtgnnnnnnnnnnnnnnnn-atgcttgtccatttctactttattgtatatctttctggaatgcttcctcacttgtttattggtt--gcaaggtt |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47948552 |
ccgcatgtgtttttattttattttttatgcttgtccatttctactttattgtatatctttctggaatgcttcctcacttgtttattggttttgcaaggtt |
47948651 |
T |
|
| Q |
308 |
ttaatcccaaatttcttttataactaggcgaaccactagtcttaatggcaaatagttgcacttggtttttgcccatcatcattgttcatttgattccaga |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47948652 |
ttaatcccaaatttcttttataactaggcgaaccactagtcttaatggcaaatagttgcacttggtttttgcccatcatcattgatcatttgattccaga |
47948751 |
T |
|
| Q |
408 |
tcccttgcaaagtatagttctttgcatttttctgannnnnnncataaccttgatcaacacagttgattgcttaggtttgtccagactccagag |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47948752 |
tcccttgcaaagtatagttctttgcatttttctgatttttttcataaccttgatcaacacagttgattgcttaggtttgtccagactccagag |
47948844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University