View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_low_28 (Length: 284)
Name: NF3011_low_28
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 50301686 - 50301467
Alignment:
| Q |
1 |
aattaagcgttaattctctatctcttgcaagagcattcatttcctaagctggtccccgatacttctatgatcatcctgtatcgattgagcgattttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301686 |
aattaagcgttaattctctatctcttgcaagagcattcatttcctaagctggtccccgttacttctatgatcatcctgtatcgattgagcgattttttat |
50301587 |
T |
|
| Q |
101 |
taatgaaatgatgatggactacaatatctttttattagcaccgttgcttaatgattaaaacaccacattcggattctctaagtccatttttattgacaaa |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301586 |
taatgaaatgatgatgaactacaatatctttttattagcaccgttgcttaatgattaaaacaccacattcggattctctaagtccatttttattgacaaa |
50301487 |
T |
|
| Q |
201 |
gaaaggaatgtatcgcatgg |
220 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
50301486 |
gaaaggaatgtatcacatgg |
50301467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University