View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_low_29 (Length: 262)
Name: NF3011_low_29
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 8350637 - 8350786
Alignment:
| Q |
17 |
agaaagttcatagaattctgcataaacttattttaggtattgattagtatcaaccttttaacatcgtgcatggtaaaaccatggtgagcaaatgcatatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8350637 |
agaaagttcatagaattctgcataaacttattttaggtattgattagcatcaaccttttaacatcgtgcatggtaaaaccatggtgagcaaatgcatatg |
8350736 |
T |
 |
| Q |
117 |
aatcaaacaagttttgcatatcataccctccaacatgtacattccatgaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8350737 |
aatcaaacaagttttgcatatcatactctccaacatgtacattccatgaa |
8350786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 154 - 239
Target Start/End: Original strand, 8412058 - 8412143
Alignment:
| Q |
154 |
tacattccatgaaaccttgctccttctttcatgccttttgtcaaacagtttttatacatgtttgaaggcatgtccttataagatat |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||||||||||| ||| ||| |||||||||| |||||||||||||| |
|
|
| T |
8412058 |
tacattccatgaaaccttgatccttctttcacgctttttgtcaaacagtttccatagatggttgaaggcatttccttataagatat |
8412143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 73 - 142
Target Start/End: Complemental strand, 8479948 - 8479879
Alignment:
| Q |
73 |
tttaacatcgtgcatggtaaaaccatggtgagcaaatgcatatgaatcaaacaagttttgcatatcatac |
142 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8479948 |
tttaacattatgcatggcaaaataatggtgagcaaatgcatatgaatcaaacaagtgttgcatatcatac |
8479879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 8479814 - 8479759
Alignment:
| Q |
154 |
tacattccatgaaaccttgctccttctttcatgccttttgtcaaacagtttttata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
8479814 |
tacattccatgaaaccttgctccttctttcgtgcagtttgtcaaacagtttctata |
8479759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 142
Target Start/End: Original strand, 8451605 - 8451646
Alignment:
| Q |
101 |
tgagcaaatgcatatgaatcaaacaagttttgcatatcatac |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8451605 |
tgagcaaatgcatatgaatcaaacaagtgttgcatatcatac |
8451646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 216 - 256
Target Start/End: Original strand, 8350783 - 8350823
Alignment:
| Q |
216 |
tgaaggcatgtccttataagatatccccctgtctctgctcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8350783 |
tgaaggcatgtccttataagatatccccctgtctcttctcc |
8350823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University