View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3011_low_33 (Length: 251)

Name: NF3011_low_33
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3011_low_33
NF3011_low_33
[»] chr4 (1 HSPs)
chr4 (10-216)||(20975881-20976087)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 20975881 - 20976087
Alignment:
10 agaagaagtaaacaatcagaggaagcactgaatcaggaaataatgaagagnnnnnnnc-cacannnnnnnncttcttcgtggttgaaggatgcannnnnn 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||         ||||        |||||| ||||||||||||||||          
20975881 agaagaagtaaacaatcagaggaagcactgaatcaggaaataatgaagagaaaaaaaaacacattttttttcttctttgtggttgaaggatgcatttttt 20975980  T
109 nnaacaagtaattgaaggattataaataacagaagaagcaaagaataaattgatcatataactagggactaaaggatcaaaagtggaatattgaaatgat 208  Q
      ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
20975981 t-aacaagtaattgaaggattctaaataacagaagaagcaaagaataaattgatcatataactagggactaaaggatcaaaagcggaatattgaaatgat 20976079  T
209 gattgaag 216  Q
    ||||||||    
20976080 gattgaag 20976087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University