View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_low_35 (Length: 244)
Name: NF3011_low_35
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_low_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 2627538 - 2627320
Alignment:
| Q |
12 |
gtataggaaaccggccaaaataaaattttgtcaaagtcttttgattgtaaagtcttttaaattcttattgtaacccaaaatactaaagtggagtggcagg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627538 |
gtataggaaaccggccaaaataaaattttgtcaaagtcttttgattgtaaagtcttttaaattcttattgtaacccaaaatactaaagtggagtggcagg |
2627439 |
T |
 |
| Q |
112 |
cagtaacaggccaactaagtccaactatgatgactttaccttagaatttcttaatttgattctagtagtaatgcctagttagtcagtttagacttagtta |
211 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627438 |
cagtaacaggccaactaggtcc--------------tgccttagaatttcttaatttgattctagtagtaatgcctagttagtcagtttagacttagtta |
2627353 |
T |
 |
| Q |
212 |
tttatattaagctacgtatcagaaactgtctgc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2627352 |
tttatattaagctacgtatcagaaactgtctgc |
2627320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University