View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3011_low_43 (Length: 227)
Name: NF3011_low_43
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3011_low_43 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 21447701 - 21447916
Alignment:
| Q |
13 |
ttgatgtatttacattttcacaaaataaagttgcacacaataaaa-gtcaatatcaatgaacatggctatagaatacataattacaatttaaatcaaaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21447701 |
ttgatgtatttacattttcacaaaataaagttgcacacaataaaaagtcaatatcaatgaacatggctatagaatacataattacaatttaaaccaaaat |
21447800 |
T |
 |
| Q |
112 |
atgagaaatattgattaagaaatctagcaactcatgatcttttgtcccttttttcatcattcatactagtatactttttagaaagcctaagaagaagata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447801 |
atgagaaatattgattaagaaatctagcaactcatgatcttttgtcccttttttcatcattcatactagtatactttttagaaagcctaagaagaagata |
21447900 |
T |
 |
| Q |
212 |
ctagtaggaaaccttt |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21447901 |
ctagtaggaaaccttt |
21447916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University