View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3011_low_44 (Length: 203)

Name: NF3011_low_44
Description: NF3011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3011_low_44
NF3011_low_44
[»] chr4 (1 HSPs)
chr4 (98-188)||(19387987-19388077)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 98 - 188
Target Start/End: Complemental strand, 19388077 - 19387987
Alignment:
98 caagatggtgattgaagaaggaactgagaatacggtggtattgatgtaaattcgaccacaatttcagttatggacgttgcttgttgtgatt 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19388077 caagatggtgattgaagaaggaactgagaatacggtggtattgatgtaaattcgaccacaatttcagttatggacgttgcttgttgtgatt 19387987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University