View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_high_28 (Length: 242)
Name: NF3013_high_28
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 4082413 - 4082224
Alignment:
| Q |
18 |
attggaactctagtctcttgtctcattctcgtcttctttcttttgtttttaaatctatattgttaacatggtatctaagagatcgatttgattttgggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082413 |
attggaactctagtctcttgtctcattctcgtcttctttcttttgtttttaaatctatattgttaacatggtatctaagagatcgatttgattttgggat |
4082314 |
T |
 |
| Q |
118 |
ctactataaagtggcccattgcatcttttaattgtttcactcgtctttaattgcgc---cgcgatttgatttcatcttgaactcgcattg |
204 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| |||| |||||||||||||| ||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
4082313 |
ctactataaaatggtccattgcatcttttagttgtctcactcgtctttaactgcgccgtcgtgatttgatttcatcttaaactcgcattg |
4082224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University