View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_high_34 (Length: 236)
Name: NF3013_high_34
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_high_34 |
 | |
|
| [»] scaffold0148 (2 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 46496149 - 46496376
Alignment:
| Q |
1 |
caatcatctccgtcccgtttccagtcttcactgtagatccaacacaacaacaacaacttcaattgcttttttcgaatttgggtctcaaaaactcaaactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46496149 |
caatcatctccgtcccgtttccagtcttcactgtagatctaacacaacaacaacaacttcaattgcttttttcgaatttgggtctcaaaaactcaaactt |
46496248 |
T |
|
| Q |
101 |
ttttctcagattggaattcnnnnnnncaggatgagggagtcgannnnnnnnctcgaatttgaatttcacatttgtgttgttgttgttgctaatttgattc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46496249 |
ttttctcagattggaattcaaaaaaacaggatgagggagttgattttttttctcgaattcgaatttcacatttgtgttgttgttgttgctaatttgattc |
46496348 |
T |
|
| Q |
201 |
tcgaaggaggagggaacagtgtgatgat |
228 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
46496349 |
tcgaaggaggagggaacagtgtgctgat |
46496376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 44 - 119
Target Start/End: Original strand, 25609380 - 25609454
Alignment:
| Q |
44 |
acaacaacaacaacttcaattgcttttttcgaatttgggtctcaaaaactcaaacttttttctcagattggaattc |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25609380 |
acaacaacaacaact-caattgcttttttcgaatttgggtctcaaaaactcaaactcttttctcagattggaattc |
25609454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 13876120 - 13876003
Alignment:
| Q |
1 |
caatcatctccgtcccgtttccagtcttcactgtagatccaacacaacaacaacaacttcaattgcttttttcgaatttgggtctcaaaaactcaaactt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
13876120 |
caatcatctttgtcccgtttccagtcttcactgtaaatccaacacaacaagaacaacttcaattgctttttttgaatttgggtctcaaaaactgaaactt |
13876021 |
T |
|
| Q |
101 |
ttttctcagattggaatt |
118 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
13876020 |
ttttctcatattggaatt |
13876003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 228
Target Start/End: Complemental strand, 13875951 - 13875909
Alignment:
| Q |
186 |
ttgctaatttgattctcgaaggaggagggaacagtgtgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13875951 |
ttgctaatttgattctcgaaggaggagggaacagtgtgctgat |
13875909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 104
Target Start/End: Original strand, 15314 - 15375
Alignment:
| Q |
44 |
acaacaacaacaacttcaattgct-tttttcgaatttgggtctcaaaaactcaaactttttt |
104 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15314 |
acaacaacaacaacttgaattgctctttttcaaatttgagtctcaaaaactcaaactttttt |
15375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 15427 - 15485
Alignment:
| Q |
165 |
ttcacatttgtgttgttgttgttgctaatttgattctcgaaggaggagggaacagtgtg |
223 |
Q |
| |
|
|||| ||||||| ||||||||||||| ||||||||||||| ||| |||||||| |||| |
|
|
| T |
15427 |
ttcaaatttgtgctgttgttgttgctgttttgattctcgaatgagtagggaacaatgtg |
15485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University