View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3013_high_38 (Length: 204)

Name: NF3013_high_38
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3013_high_38
NF3013_high_38
[»] chr1 (2 HSPs)
chr1 (21-157)||(4079236-4079372)
chr1 (1-33)||(4082317-4082349)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 21 - 157
Target Start/End: Original strand, 4079236 - 4079372
Alignment:
21 gatatgattttggtccctcaaaaaatgattttggaattttattagtttcaatgagatgtgatgtttattttttaatgactgtgttgtatgatacatttca 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
4079236 gatatgattttggtccctcaaaaaatgattttggaattttattagtttcaatgagatgtgatgtttattttttgatgactttgttgtatgatacatttca 4079335  T
121 ttgactttctatataaatgtcgtgtcttttatttatt 157  Q
    |||||||||||||||||||||||||||||||||||||    
4079336 ttgactttctatataaatgtcgtgtcttttatttatt 4079372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 4082349 - 4082317
Alignment:
1 aacatggtatctaagagatcgatatgattttgg 33  Q
    ||||||||||||||||||||||| |||||||||    
4082349 aacatggtatctaagagatcgatttgattttgg 4082317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University