View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_low_30 (Length: 250)
Name: NF3013_low_30
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_low_30 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 9245416 - 9245655
Alignment:
| Q |
13 |
aatatagttgttttcaatgc--ggagctaaaatcaataatgaacatgaatttttgctgctgaattatcagttccacgtgtcctttgaatgaatttgacac |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9245416 |
aatatagttgttttcaatgcatggagctaaaatcaataatgaacatgaatttttgctgttgaattatcaattccacgtgtcctttgaatgaatttgacac |
9245515 |
T |
 |
| Q |
111 |
ccttacgaccttcgtggaacttagaagacttgagaaatatttgtctaactcgtttacggatgttcttaatttgattgacccttattcgtcaacttgagca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9245516 |
ccttacgaccttcgtggaacttagaagacttgagaaatatttgtctaactcgtttacggatgttcttaatttgattgacccttattcgtcaacttgagca |
9245615 |
T |
 |
| Q |
211 |
tttgtccatctcctactaacaacttagattattattaagt |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9245616 |
tttgtccatcttctactaacaacttagattattattaagt |
9245655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University