View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_low_37 (Length: 237)
Name: NF3013_low_37
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 46301766 - 46301564
Alignment:
| Q |
12 |
aatactactataatgaaaatgaaaa-tacacataactttatccgtgaaaaagttattaaaaaatcgcatcactgttgcaatggaagtctttgagagtgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301766 |
aatactactataatgaaaatgaaaaatacacataactttatccgtgaaaaagttattaaaaaatcgcatcactgttgcaatggaagtctttgagagtgaa |
46301667 |
T |
 |
| Q |
111 |
aaaagggggaatagttaagtaaacgactgtttcaatcatcaaggaaaatcataaaacagtgtagctatttttagtaatgatacaactaaaacacaaaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301666 |
aaaagggggaatagttaagtaaacgactgtttcaatcatcaaggaaaatcataaaacagtgtagctatttttagtaatgatacaactaaaacacaaaaat |
46301567 |
T |
 |
| Q |
211 |
ata |
213 |
Q |
| |
|
||| |
|
|
| T |
46301566 |
ata |
46301564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University