View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_low_41 (Length: 229)
Name: NF3013_low_41
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 72 - 214
Target Start/End: Original strand, 27732836 - 27732978
Alignment:
| Q |
72 |
gtattttaataatttaataatatcatgtacaaaagcttacctgcatttttaatttcttgtccaataggtacatccagatatgatccaataagtaaagagc |
171 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27732836 |
gtattttaataatttaataatatcacggacaaaagcttacctgcatttttaatttcttgtccaataggtacatccagatatgatccaataagtaaagagc |
27732935 |
T |
 |
| Q |
172 |
tgtcagcactagcaagcttagcagccaatccatcagattcaaa |
214 |
Q |
| |
|
|||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27732936 |
tgtcggcacttgccagcttagcagccaatccatcagattcaaa |
27732978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 73
Target Start/End: Original strand, 27732759 - 27732800
Alignment:
| Q |
32 |
gacaaaccaacaaatcagacagtaatttgagcctcgaaaggt |
73 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||| |
|
|
| T |
27732759 |
gacaaagcaacaaatcagacagtaatttgagcccccaaaggt |
27732800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University