View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3013_low_44 (Length: 204)
Name: NF3013_low_44
Description: NF3013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3013_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 21 - 157
Target Start/End: Original strand, 4079236 - 4079372
Alignment:
| Q |
21 |
gatatgattttggtccctcaaaaaatgattttggaattttattagtttcaatgagatgtgatgtttattttttaatgactgtgttgtatgatacatttca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
4079236 |
gatatgattttggtccctcaaaaaatgattttggaattttattagtttcaatgagatgtgatgtttattttttgatgactttgttgtatgatacatttca |
4079335 |
T |
 |
| Q |
121 |
ttgactttctatataaatgtcgtgtcttttatttatt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4079336 |
ttgactttctatataaatgtcgtgtcttttatttatt |
4079372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 4082349 - 4082317
Alignment:
| Q |
1 |
aacatggtatctaagagatcgatatgattttgg |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
4082349 |
aacatggtatctaagagatcgatttgattttgg |
4082317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University