View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3014_low_11 (Length: 240)

Name: NF3014_low_11
Description: NF3014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3014_low_11
NF3014_low_11
[»] chr4 (1 HSPs)
chr4 (20-217)||(56312444-56312641)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 56312444 - 56312641
Alignment:
20 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaacttccgttca 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
56312444 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaacttccgttca 56312543  T
120 attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagattaccccaacatga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56312544 attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagattaccccaacatga 56312641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University