View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3014_low_11 (Length: 240)
Name: NF3014_low_11
Description: NF3014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3014_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 56312444 - 56312641
Alignment:
| Q |
20 |
gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaacttccgttca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
56312444 |
gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaacttccgttca |
56312543 |
T |
|
| Q |
120 |
attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagattaccccaacatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312544 |
attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagattaccccaacatga |
56312641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University