View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3014_low_6 (Length: 261)
Name: NF3014_low_6
Description: NF3014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3014_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 25 - 245
Target Start/End: Original strand, 51527691 - 51527914
Alignment:
| Q |
25 |
ctcaattttgtttttgatgcttaagctctaattcttgacagggtttgtgagttaattaatttgagagtgggaatctgaatctgtatctaaatggaggctg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51527691 |
ctcaattttgtttttgatgcttaagctctaattcttgacagggtttgtgagttaattaatttgagagtgggaatctgaatctgtatataaatggaggctg |
51527790 |
T |
 |
| Q |
125 |
aaaaggatgcgtctatcagacagtacacaaatgaggaagtggatgatgatggaagaatcaagagaaccggtaagcatgttttctctatc---tttccagt |
221 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51527791 |
aaaaggatgtgtctatcaaacagtacacaaatgaggaagtggatgatgatggaagaatcaagagaaccggtaagcatgttttctctatctaatttccagt |
51527890 |
T |
 |
| Q |
222 |
tataataactgcatttcatttcat |
245 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51527891 |
tataataactgcatttcatttcat |
51527914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University