View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3014_low_7 (Length: 254)
Name: NF3014_low_7
Description: NF3014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3014_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 32730194 - 32730432
Alignment:
| Q |
1 |
tataagtatagttggatgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730194 |
tataagtatagtcggatgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatca |
32730293 |
T |
|
| Q |
101 |
accaagatctccgttcagcattcaatcatttcaactggtttagttctagattatttctaatcatatatttatgttgatcacaaagtcaaaaattaattaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730294 |
accaacatctccgttcagcattcaatcatttcaactggtttagttctagattatttctaatcatatatttatgttgatcacaaagtcaaaaattaattaa |
32730393 |
T |
|
| Q |
201 |
tgtgatttatatttttaaaatttctgatttattgttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32730394 |
tgtgatttatatttttaaaatttcttatttattgttcat |
32730432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 38090094 - 38090182
Alignment:
| Q |
17 |
tgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatcaaccaa |
105 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| || || ||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
38090094 |
tgcaatggcgctttaatctcccatcttcatataattgcaccggagaatagtcccaacaccgatggaattgatatttcaagatcaaccaa |
38090182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University